WEEK 1:
8/13/13 1) What 3 things should be written at the start of class without being told?
2) How much talking is allowed at the start of class?
8/14/13 1) What needs to be done before the tardy bell rings?
2) List the 5 sections that need to be in your 3-ring folder.
8/15/13 1) Think of some experiments you've done in past years. List some steps that are common to every experiment.
WEEK 2:
8/18/13 1) What is a hypothesis?
2) Does it matter if your hypothesis turns out to be incorrect? Explain.
8/19/13 1) What are some resources you can use to "gather information" before doing an experiment?
2) When should you write a conclusion?
8/20/13 1) Describe some ways that you can record the result of an experiment.
8/21/13 1) Use dimensional analysis to find the number of years in 6832800 minutes.
8/22/13 1) Convert by moving the decimal point:
a) 321.4 dm = _____mm
b) 43.75 cm = ____hm
2) Why can't you just move the decimal point with time conversions?
WEEK 3:
8/26/13 1) Convert
a) 750 mm = ______ km
b) .0048 dkm = _______ cm
c) 100.4 dg = _______ g
8/27/13 1) What units (mm, cm, m, or km)would be best to measure the following?
a) length of your finger
b) thickness of a penny
c) distance to downtown los angeles
d) distance across the classroom
8/28/13 1) What units (mL, L, or kL) would be best to measure the following?
a) water in a pool
b) soda can
c) bucket of water
8/29/13 1) In this class, we will measure things using the ________ system.
2) When using a ruler, we will never measure with the ________ side.
WEEK 4:
9/3/13 1) List 3 possible explanations why Diet Coke floats in water while regular Coke sinks.
9/4/13 1) If all the following were placed in a graduated cylinder, draw what would happen:
Object Density
water 1.0
plastic 1.16
wood 0.7
bead .95
oil .925
glycerin 1.26
marble 2.4
9/6/13 1) Density = ?
2) Units for solids will be g/cm3, but liquids should be ________.
Week 5:
9/9/13 1) If 2 objects are the same size, the one with the greater _________ will be denser.
2) Why does oil float above water?
9/10/13 1) Steel has a greater density than water, yet a steel boat floats. Explain.
9/11/13 1) Draw the forces on a boat.
2) Which force must be larger? (boat is sinking)
9/12/13 1) The buoyant force is equal to the weight of the fluid ___________.
2) If the buoyant force is greater than the weight, an object will ____________.
9/13/13 1) Which boat has the larger buoyant force?
<<picture of 2 boats with different amounts of fluid displaced>>
Week 6:
9/16/13 1) Explain why a person can lie down on a "bed of nails" without getting injured.
9/17/13 1) Why can't a scuba diver survive thousands of feet underwater?
2) If a force is exerted on a small area, the pressure will be ___________.
9/18/13 1) What would happen to an unopened bag of chips taken to the top of Mount Everest? Explain.
2) Find Pressure if F=63 N and A=3 m^2
9/19/13 1) At the bottom of a mountain, there is higher air pressure because ________________.
2) Find Pressure if F=48 N and A=8 m^2
Week 7
9/23/13 1) Las Vegas is 280 miles away. How fast must one drive to get there in 4 hours?
2) Label the coordinates of each point:
<<picture of a graph with points at (0,0), (2,20), and (4,40)
9/24/13 1) The slope of a distance vs. time graph is _________.
2) Find the slope of the graph:
<<picture of a graph with points at (0,0), (2,40), (4,80), and (6,120)
9/25/13 1) A runner travels at 8 km/h for 180 minutes. How far did he/she run?
9/26/13 1) A bus's maximum speed is 120 km/h. Is it possible for the bus to travel 730 km in 6 hours? Explain.
9/27/13 1) Johnny walks at a speed of 2.5 m/s. If his next class is 800 m away, will he make it there on time?
Week 8
9/30/13 1) A car accelerates when getting on and off the freeway. Define acceleration.
2) Find the average speed.
<<picture of a graph with points at (0,0), (2,100), and (4,200)
10/1/13 1) Give an example of each of the 3 types of acceleration.
10/2/13 1) A car travels north at 60 miles/hr for 10 minutes. Is the car accelerating? Explain.
10/3/13 1) You are in a car going 60 miles per hour. You throw a ball in the air in front of you. Does it hit you in the face? Explain.
10/4/13 1) Net force? Balanced or unbalanced?
a) 8 N right, 17 N left
b) 13 N right, 6 N left, 7 N left
c) 16 N right, 9 N right, 4 N left, 7 N left
Week 9
10/7/13 1) Newton's 2nd Law states that Force = ______ x _______
2) When forces are ___________, you will have a change in velocity.
10/8/13 1) A soccer ball is rolled with the same force on notebook paper, napkins, and sandpaper. On which surface will the ball
roll the furthest? Explain.
2) Describe the difference between kinetic and static friction.
10/9/13 1) Label all forces in the diagram.
<<picture of a boat moving to the right>>
10/10/13 1) Label all forces in the diagram.
<<picture of a car going up a hill>>
10/11/13 1) Label all forces in the diagram.
<<picture of a person lying down>>
Week 10
10/14/13 1) Label all forces in the diagram.
<<picture of a shoe being pulled with a spring scale>>
10/15/13 1) Label all forces in the diagram.
<<picture of a hangman>>
10/16/13 1) In a force diagram, why are different size arrows used?
10/17/13 1) Momemtum = _______ x ________
2) Find the momemtum of a 140 kg boy running 3 m/s
10/18/13 1) An object that is not moving always has a momentum of _________.
2) The Law of __________ says that the total momentum before and after a collision is _________.
Week 11
10/21/13 1) Newton's 3rd Law states that for every _________, there is an equal and opposite ___________.
10/22/13 1 Give 2 examples of Newton's 3rd Law.
10/23/13 1) Describe and give 2 examples of elastic collisions.
10/24/13 1) Describe and give 2 examples of inelastic collisions.
10/25/13 1) Label all forces in the diagram.
<<picture of a student sleeping on his desk>>
Week 12
10/28/13 1) List 3 things that have energy and why you believe so.
10/29/13 1) Make a t-chart to identify differences between kinetic and potential energy.
10/30/13 1) Energy from food/drink that is unused gets stored in the body as ______.
2) What type of energy is in food/drink?
10/31/13 1) Chemical potential _________ from the nut is transferred to the _____________ which we measure using a ___________________.
11/1/13 1) Gravitational potential energy, kinetic energy, both, or none?
a) a pencil on the ground
b) a thrown baseball
c) a rock on the edge of a cliff
d) a bowling ball rolling
Week 13
11/4/13 1) The law of _________ of energy states that energy cannot be created or _____________. It can only be ________ from one form
to another.
11/5/13 1) A basketball is held 2 meters in the air and dropped to the floor. Eventually it stops bouncing and has no energy. Where
did the energy go?
11/6/13 1) List 3 things that you know or have heard about global warming.
11/7/13 1) Explain how global warming could result in some species going extinct.
11/8/13 1) List 4 things that can be done to help solve the global warming problem.
Week 14
11/12/13 1) Label the diagram showing where there would be PE, KE, and both.
<<picture of a roller coaster with 4 parts of the track to label>>
11/13/13 1) Describe the features of a good roller coaster. (use the terms PE, KE, rolling friction, air resistance)
11/14/13 1) Explain how you can find the PE at the start of a roller coaster
2) Explain how you can find the KE at the end of a roller coaster.
11/15/13 1) Calculate the gravitational PE of a 400 kg roller coaster that is at the top of a 40 m hill.
Week 15
11/18/13 1) Describe how you will find the velocity of the marble at the end of the roller coaster?
11/19/13 1) The marble will have less energy at the end of your roller coaster. Why?
11/21/13 1) List some similarities and differences between a cup of water, an ice cube, and steam.
11/22/13 1) Give 3 examples of each of the states of matter.
Week 16
12/2/13 1) Draw the change of state graph, labeling all stages.
12/3/13 1) Draw the arrangement of particles in a solid, liquid, & gas.
12/4/13 1) Complete the change of state graph for dry ice.
12/5/13 1) What happens to the temperature while a substance undergoes a change of state?
12/6/13 1) 0 C is the melting point of water. 0 C is also called the _______ point.
Week 17
12/9/13 1) 100 C is the boiling point of water. It is also the temperature that water vapor __________.
12/10/13 1) A pure substance that cannot be separated into simpler substances is called an ____________.
2) Some examples include oxygen, _________, __________, & __________.
12/11/13 1) Compound or mixture?
a) water
b) sandwich
c) deck of playing cards
d) table salt
12/12/13 1) Chlorine is dissolved in a swimming pool. What is the solute? Solvent?
12/13/13 1) Last year, you learned that all living things are made of ________.
2) All things, living or non, are made of ___________.
Week 18
12/16/13 1) How many protons, neutrons, and electrons does iron (Fe) have?
12/17/13 1) The ______ table lists all the known ________ in the universe.
2) Particles that orbit the nucleus are the negatively charged __________.
12/18/13 1) Find the number of protons , neutrons, and electrons for calcium (Ca).
12/19/13 1) Find the number of protons , neutrons, and electrons for Hydrogen (H).
12/20/13 1) Find the number of protons, neutrons, and electrons for gold (Au).
Week 19
1/13/14 1) Draw a Lewis Dot structure for Be and Mg (both from group 2). What can you conclude about the relationship between valence
electrons and group #?
1/14/14 1) Draw a Lewis Dot structure. What do these atoms want?
a) S b) F c) Li d)Ca
1/15/14 1) Show how Mg and O will form an ionic bond.
1/16/14 1) Look at the Lewis Dot structures for Carbon and Oxygen. Could carbon monoxide (CO) be formed by an ionic bond? Explain.
1/17/14 1) Draw the Lewis Dot structure for carbon dioxide.
2) Make the model for carbon dioxide.
Week 20
1/21/14 1) Draw the Lewis Dot structure for water.
2) Make the model for water.
1/22/14 1) Describe how the Science Fair experiment is different from a classroom experiment.
1/23/14 1) What is a procedure and why is it important?
1/24/14 1) What is a reference list? What will it be used for?
Week 21
1/27/14 1) A 2H2 + O2 ----> 2H2O
B raisins + m&m's + nuts ----> trail mix
A is a chemical reaction, but B is not. explain why
1/28/14 1) Give 2 examples of a physical change and 2 examples of a chemical change
1/29/14 1) Endothermic or exothermic reaction?
a) burning candle
b) glow stick
c) cold pack
d) photosynthesis
e) fireworks exploding
1/30/14 1) List the 5 indicators of a chemical reaction.
2) Do they always indicate a chemical reaction?
1/31/14 1) What happens to bonds when a chemical reaction occurs?
Week 22
2/3/14 1) First the penny will be coated with zinc to make it look ________. Then it will be _______ to make the copper and zinc bond to form _________.
2/4/14 1) Substances you start with are called __________ and substances that are made are called _________.
2/5/14 1) How many oxygen atoms?
a) H2O
b) 3H2O
c) CO2
d) Zn(NO3)2
2/6/14 1) How many hydrogen atoms?
a) 3NaOH
b) 2C2H5OH
2/7/14 1) Why must a chemical equation always be balanced?
2) Balance the equation: H2 + O2 ---> H2O
Week 23
2/10/14 1) Describe what you think of when you hear the word "acid".
2/11/14 1) Complete the chart:
Red Litmus Paper Blue Litmus Paper
Acid
Base
Neutral
2/12/14 1) Acids taste sour and bases taste bitter. Why would that be a dumb way to test unknown substances?
2) What part of the pH scale is best suited for living things?
2/13/14 1) Make a Venn diagram that describes some similaritites and differences between acids and bases
2/14/14 1) Explain how the pH scale is organized (Label A-E)
0--------------6-7-8-------------14
A B C D E
Week 24
2/18/14 1) Orange juice has a pH = 5 while Coke's pH = 3. Would your tongue be a good indicator to identify this difference? Explain.
2/19/14 1) How could you use pH paper and lithmus paper to test a solid like salt or bread?
2/20/14 1) Is phenolphthalein more like litmus paper or pH paper? Explain.
2/21/14 1) Is Bromothymol blue more like litmus paper or pH paper? Explain.
Week 25
2/24/14 1) The "lead" in a pencil and a diamond are both made of carbon. How could this be possible?
2/25/14 1) The body's main source of energy is from __________. Reserve energy is stored as ____________.
2) When iodine touches starch, it turns _________ color.
2/26/14 1) Based on yesterday's activity, which food groups contained carbohydrates?
2/27/14 1) The element ________ forms the backbones of many molecules important for living things. These molecules include carbohydrates, ___________,
_______________, and __________________.
2/28/14 1) In yesterday's experiment, _______ reacts first with vitamin C. When all the vitamin C runs out, the iodine then reacts with ___________
and turns a __________ color.
Week 26
3/3/14 1) A monomer is a single unit while a polymer is a _______________________.
2) Name 3 examples of polymers.
3/4/14 1) List some nutrients that are monomers that your body needs.
3/5/14 1) Sometimes a criminal is caught because he left blood, skin, or hair at a crime scene. Explain.
3/6/14 1) What is DNA and why is it important?
3/7/14 1) Transcribe and translate:
DNA: TAC GAT TAG CAT ACT
Week 27
3/10/14 1) Transcribe and translate:
DNA: CCGTATTACGTCGAGACTTGTAG
3/11/14 1) DNA is transcribed to RNA in the _______ of cells. The RNA is transported to the __________ where it is translated into _________.
3/14/14 1) How can astronomers gather information about other planets and stars?
Week 28
3/17/14 1) Astronomers can study emissions and _______ lines to find the ________ of a star.
3/18/14 1) Describe 2 reasons that one star may appear brighter than another star in the night sky.
3/19/14 1) Describe the difference in color between cool, average, and hot stars.
3/20/14 1) Describe how temperature and luminosity are related.
2) Astronomers measures distances to stars in ________ years.
3/21/14 1) List the stages in the life cycle or our sun. What stage is it in now?
Week 29
3/24/14 1) Looking up at the night sky, it is possible that a star you see isn't even there anymore. Explain.
3/25/14 1) Large stars do not become white dwarfs at the end of their lives. What are the 3 possible outcomes?
3/26/14 1) What is a black hole?
3/27/14 1) What is the name of our galaxy?
2) List some objects that are in a galaxy.
3/28/14 1) Briefly describe the 3 types of galaxies. Which type is ours?
Week 30
4/1/14 1) 2 Galaxies that are closer will move apart at a speed that is _______ than 2 galaxies that are further apart.
2) Ever since the universe was created in the ________ ________, it has been expanding.
4/2/14 1) List 5 types of satellites.
2) Why do rockets have stages when they are launched into space?
4/3/14 1) Explain how Newton's 3rd Law applies to a rocket taking off.
4/4/14 1) The moon doesn't produce its own light. Why does it appear to shine at night?
Week 31
4/7/14 1) A lunar eclipse occurs when ____________'s shadow is on the ____________.
2) A solar eclipse occurs when the ________ goes between the ________ and the earth.
4/8/14 1) Man has not visited the moon since 1972 on Apollo 17. Why don't you think we have returned?
4/9/14 1) Where in space do you think man will travel next? Why?
4/10/14 1) Apollo's command module enters earth's atmosphere at over 24000 miles/hr. Would they have a chance to survive without parachutes?
Explain.
4/11/14 1) How did the astronauts in the Apollo missions return to earth?
Week 32
4/21/14 1) The only place man has visited other than earth is the moon. What type of problems prevent man from traveling further?
4/22/14 1) The U.S. has been reducing NASA's budget lately. Do you think spending on NASA is important? Explain.
4/23/14 1) What would be required for a space station on the moon?
4/24/14 1) The closest star to Earth is _________. Why is it important for us?
Week 33
4/28/14 1) List some objects that could be found in our solar system.
4/29/14 1) Why aren't distances within our solar system measured in light-years?
Week 35
5/12/14 1) What are some things you can do to make sure your Science Fair display board looks great?
5/13/14 1) Should you read everything on your display board for your presentation? Why or why not?
5/14/14 1) List 2 questions that could be asked about any science fair experiment.
5/15/14 1) Why is eye contact important when giving a presentation?
5/16/14 1) List some things that went well and things that could be improved from this year's science fair experiment.
|